View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12806_high_8 (Length: 237)

Name: NF12806_high_8
Description: NF12806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12806_high_8
NF12806_high_8
[»] chr8 (1 HSPs)
chr8 (1-221)||(43183648-43183868)


Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43183868 - 43183648
Alignment:
1 gtgcacggtgaaccgagtgattcttgcacctccgttgatagctatgtccaatgaagcggacaaaaacgaacctgccgcgccggaggaggtggtggtgacg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43183868 gtgcacggtgaaccgagtgattcttgcacctccgttgatagctatgtccaatgaagcggacaaaaacgaacctgccgcgccggaggaggtggtggtgacg 43183769  T
101 gctgtgacaagggagaagtgcgtaggaatgaataacaagggagtgagttggggacatacttcggtgattggaagacggagagagatggaagacgccgtcg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43183768 gctgtgacaagggagaagtgcgtaggaatgaataacaagggagtgagttggggacatacttcggtgattggaagacggagagagatggaagacgccgtcg 43183669  T
201 ctgttattccgggattcatgt 221  Q
    |||||||||||||||||||||    
43183668 ctgttattccgggattcatgt 43183648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University