View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12807_high_5 (Length: 305)
Name: NF12807_high_5
Description: NF12807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12807_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 36891230 - 36891525
Alignment:
| Q |
1 |
cttctctatagggttgatggccactctattcggtatgcgataaaaatggattctaatgccatcggtcttccnnnnnnnnnnnnnnnnnnnnngctttatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36891230 |
cttctctatagggttgatggccactctattcggtatgcgataaaaatggattctaatgccatcggtcttccttttttatgtttaatttttttgctttatt |
36891329 |
T |
 |
| Q |
101 |
cctttgattgatgcttaactaactgatacatgatttaatgtgtcttcactgatacaacatcatagatatttgttccccaaaagggataataacttagctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36891330 |
cctttgattgatgcttaactaactgatacatgatttaatgtgtcttcactgatacaacatcatagatatttgttccccaaaagggataataacttaactt |
36891429 |
T |
 |
| Q |
201 |
gagcatgtaaaaagaaggaattagcttatgtcataagcttatatatatagcctttttgtaactttaggttattacatgaaatttgcatgtctctgc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36891430 |
gagcatgtaaaaagaaggaattagcttatgtcataagcttatatatatagcctttttgtaactttaggttattacatgaaatttgcatgtctctgc |
36891525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University