View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12809_high_2 (Length: 383)
Name: NF12809_high_2
Description: NF12809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12809_high_2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 13 - 383
Target Start/End: Original strand, 38096486 - 38096851
Alignment:
| Q |
13 |
gcagagatgaaagcaaagcagcaggaagggaggctgagcaatgtggggaccacaagcaaaagaagggagagtgttgatgaagagaaagtgtattctggtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096486 |
gcagagatgaaagcaaagcagcaggaagggaggctgagcaatgtggggacaacaagcaagagaagggagagtgttgatgaagagaaagtgtattctggtg |
38096585 |
T |
 |
| Q |
113 |
atgaagatatatgtgtaacggagaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096586 |
atgaagatatatgtgtaacggagaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagc |
38096685 |
T |
 |
| Q |
213 |
aaaccgggttgcttttcaagctgaacctgtgctcaagaaatctaattcctataatgaagaaaggtacgtttctcattaattacttatagaatttctttta |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
38096686 |
aaaccgggttgcttttcaagctgaacctgtgctcaagaaatctaattcctataatgaagaaaggtacgtttctc----attacttttagaatttctttta |
38096781 |
T |
 |
| Q |
313 |
tttgttgtttaatttgttaccttttgttttcttacaggagaagcaggctagggatggatgaggtgaagtta |
383 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096782 |
tttgttgtttaa-atgttaccttttgttttcttacaggagaagcaggctagggatggatgaggtgaagtta |
38096851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University