View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12809_low_5 (Length: 205)
Name: NF12809_low_5
Description: NF12809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12809_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 9e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 13 - 187
Target Start/End: Complemental strand, 40805609 - 40805434
Alignment:
| Q |
13 |
cgttcactgcaccatcaaaaaggtatctacaccatat-atgcatgccacactactagttaagcaataatatctctcaccaagacatctactaataattta |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | | || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40805609 |
cgttctctgcaccatcaaaaaggtatctacagtacaccatatatgccactctactagttaagcaataatatctctcaccaagacatctactaataattta |
40805510 |
T |
|
| Q |
112 |
atgttgaatttaacttatttataattaatttttatctgtattttgcagagattattagcttttggatgttgggaag |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40805509 |
atgttgaatttaacttatttataattaatttttatctgtattttgcagagattactagcttttggatgttgggaag |
40805434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 187
Target Start/End: Complemental strand, 40826014 - 40825978
Alignment:
| Q |
151 |
attttgcagagattattagcttttggatgttgggaag |
187 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
40826014 |
attttgcagagattactagcttttggatgctgggaag |
40825978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University