View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1280_low_18 (Length: 330)
Name: NF1280_low_18
Description: NF1280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1280_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 8e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 135 - 245
Target Start/End: Complemental strand, 41130938 - 41130828
Alignment:
| Q |
135 |
aacctagtttacctcctctttgatatcgtctccaaatcataattactattatagtctcttccttcaaaacggtacgttccatctttcttatttggtttta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41130938 |
aacctagtttacctcctctttgatatcgtctccaaatcataattactattatagtctcttccttcaaaacggtacgttccatctttcttatttaattttt |
41130839 |
T |
 |
| Q |
235 |
ataattatatt |
245 |
Q |
| |
|
||||||||||| |
|
|
| T |
41130838 |
ataattatatt |
41130828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University