View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1280_low_21 (Length: 321)
Name: NF1280_low_21
Description: NF1280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1280_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 29 - 308
Target Start/End: Complemental strand, 9966841 - 9966563
Alignment:
| Q |
29 |
aacattcatgtcaatcaaaaagaataatgctcaattttgtaagtaagccatagagttttataaatgtaatcttcttcatttatcaatattttaaaatgat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9966841 |
aacattcatgtcaatcaaaaagaataatgctcaattttataagtaagccatagagttttataaatgtaatcttcttcatttatcaatattttaaaatgat |
9966742 |
T |
|
| Q |
129 |
ttctagagttgtaaaatgttttaaaaattggagnnnnnnnnnnatatgttatcaacgcattcatgatattaatcatctgattgaatttaaatggttaatg |
228 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9966741 |
ttctacagttgtaaaatgttttaaaaattggagttttttttagatatgttatcaacgcattcatgata-taatcatctgattgaatttaaatggttaatg |
9966643 |
T |
|
| Q |
229 |
agttccacataatgttgaattgttctaaaatattcaagtttactttttaagtgaaataattcttattttactatctctct |
308 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| |||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9966642 |
agttccacataatgttaaattgttctaaaaaatttaagtttgctttttaggtgaaataattcttattttactatctctct |
9966563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University