View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1280_low_26 (Length: 311)
Name: NF1280_low_26
Description: NF1280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1280_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 56 - 301
Target Start/End: Complemental strand, 8136326 - 8136081
Alignment:
| Q |
56 |
acatcatcatccaccattattaagacaagaaggaataaagtcttggaagtcatagacgatacgtcaccatctatataaagttgtaaggtgcnnnnnnnnn |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8136326 |
acatcatcatccaccattattaagacaagaaggaataaagtcttggaagtcatagacgatacgtcaccatctatataaagttgtaaggtgcaaaaaaaga |
8136227 |
T |
 |
| Q |
156 |
nnnnnnnnncgttcactacaagataataataatgaaaataaagatggcatcacagtaaatattattatgtcattgtagatgaagccaacaataccaccaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8136226 |
aaaaaaaaacgttcactacaagataataataatgaaaataaagatggcatcacagtaaatattattatgtcattgtagatgaagccaacaataccaccaa |
8136127 |
T |
 |
| Q |
256 |
caaaattaaacattggctgatgccacatgtttctctattgtctgtg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8136126 |
caaaattaaacattggctgatgccacatgtttctctattgtctgtg |
8136081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University