View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1280_low_33 (Length: 273)
Name: NF1280_low_33
Description: NF1280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1280_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 147 - 234
Target Start/End: Complemental strand, 38090593 - 38090506
Alignment:
| Q |
147 |
cataccgtccatgtcttgattctagctccattttccgttccagtgaagatgctgtgtgacacatgcacctcttctacagtagcatatt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38090593 |
cataccgtccatgtcttgattctagctccattttccgttccagtgaagatgctgtgtgacacatgcacctcttctacagtagcatatt |
38090506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 147 - 179
Target Start/End: Complemental strand, 32730729 - 32730697
Alignment:
| Q |
147 |
cataccgtccatgtcttgattctagctccattt |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
32730729 |
cataccgtccatgtcttgattctagcaccattt |
32730697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University