View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1280_low_39 (Length: 231)
Name: NF1280_low_39
Description: NF1280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1280_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 20514108 - 20514229
Alignment:
| Q |
1 |
ttcctcttcgtaccataagctttgtacttccctccatgttagttgacggagaaataccagatga--ttgcatatactagacacattctgtgttgtactta |
98 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20514108 |
ttcctcttcgtaccataagctctgtacttccctccatgttagttgacggagaaataccagatgatgttgcatatactagacacattctgtgttgtactta |
20514207 |
T |
|
| Q |
99 |
atgtcaacaaacaatacaatcc |
120 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
20514208 |
atgtcaacaaacaatacaatcc |
20514229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 118 - 155
Target Start/End: Original strand, 20514242 - 20514279
Alignment:
| Q |
118 |
tccttcttctttgactttgtttgataagatagtataat |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20514242 |
tccttcttctttgactttgtttgataagatattataat |
20514279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University