View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1280_low_44 (Length: 202)
Name: NF1280_low_44
Description: NF1280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1280_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 30467766 - 30467572
Alignment:
| Q |
1 |
tttacacatgccatggccggggattggacatccaaatgatggtctctgcatgttatgttattttcctctatggtcagtcagccaaacttatatatggagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30467766 |
tttacacatgccatggccggggattggacatccaaatgatggtctctgcatgttatgttattttcctctatggtcagtcagccaaacttatatatggagt |
30467667 |
T |
|
| Q |
101 |
atagtttgtgtatgtgtttgtgagtaaatatatattcgacaacatacataattatgtgctatatttatatatgttggtaaatatgacaatactaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30467666 |
atagtttgtgtatgtgtttgtgagtaaatatatattcgacaacatacataattatgtgctatatttatatatgttggtaaatatgacaatactaa |
30467572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University