View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281-Insertion-5 (Length: 144)
Name: NF1281-Insertion-5
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281-Insertion-5 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 8 - 144
Target Start/End: Original strand, 11930446 - 11930582
Alignment:
| Q |
8 |
aaaacaacatatttttctctgtgatttgtgaattccacgcagtattttaatacttgcaacatgaagtgacacaaatataaataattggtaactataagtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11930446 |
aaaacaacatatttttctctgtgattagtgaattccacgcagtattttaatacttgcaacatgaagtgacacaaatataaataattggtaactataagtt |
11930545 |
T |
 |
| Q |
108 |
tcactcataagtgatcatataacaattctttcatata |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11930546 |
tcactcataagtgatcatataacaattctttcatata |
11930582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University