View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281-Insertion-7 (Length: 355)
Name: NF1281-Insertion-7
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281-Insertion-7 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 152 - 355
Target Start/End: Complemental strand, 8165585 - 8165389
Alignment:
| Q |
152 |
ttcactttttatcttatctgttgcgctaatttatcttatccttaaaatagtatttaaatcaaatatagtacaactgaaattgtctcgtcatgtctttttt |
251 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8165585 |
ttcactttttgtctcatctgttgtgctaatttatcttatccttaaaacagtttttaaatcaaatatagtacaactgaaattgtctcgtcatgtctttttt |
8165486 |
T |
 |
| Q |
252 |
atcaagctaacacaccaatagaggtttaaaagatatctccaaccatgtccacaaccacatcataatatagctattgtagcttcataggttgcattggttt |
351 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8165485 |
agcaagctaacacaccaatagaggtttaaa-------tccaaccatgtccacaaccacatcataatatagctattgtagcttcataggttgcattggttt |
8165393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 9 - 65
Target Start/End: Complemental strand, 8165945 - 8165889
Alignment:
| Q |
9 |
ttaaaagataagtatttgatataacaacacaacataagacagaatgacataagataa |
65 |
Q |
| |
|
||||||| ||||||||||| ||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
8165945 |
ttaaaaggtaagtatttgacataacaacagagcataagacagaataacataagataa |
8165889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University