View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281-Insertion-8 (Length: 357)
Name: NF1281-Insertion-8
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 191 - 347
Target Start/End: Complemental strand, 54252239 - 54252083
Alignment:
| Q |
191 |
gtcaaatagcatacatagatgaataaatgaagaatttgaagtttgatcttaggctttatgtaaacgaaatagtgatcattattgtgtttgcttgatgatt |
290 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54252239 |
gtcaaatagcataaatagatgaataaatgaagaatttgaagtttgaacttaggctctatgtaaacgaaatagtgatcattattgtgtttgcttgatgatt |
54252140 |
T |
|
| Q |
291 |
tttggatttggtgaaattattggtattttagataattattccataattcagtttgtt |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54252139 |
tttggatttggtgaaattattggtattttagataattattccataattcagtttgtt |
54252083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 9 - 69
Target Start/End: Complemental strand, 54252428 - 54252368
Alignment:
| Q |
9 |
ttcttgtacgttgttggtgatattggctacacggctcaatctgttagcttagtgatactgg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54252428 |
ttcttgtacgttgttggtgatattggctacacggctcaatctgttagcttagtgatactgg |
54252368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 180
Target Start/End: Complemental strand, 54252286 - 54252257
Alignment:
| Q |
151 |
atatgcaatgagtgattattattattataa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54252286 |
atatgcaatgagtgattattattattataa |
54252257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University