View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12810_high_11 (Length: 220)
Name: NF12810_high_11
Description: NF12810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12810_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 35294279 - 35294096
Alignment:
| Q |
18 |
gattttgtttgcaccatttaatcagagtgttctggcacaatgtgtgatggcagtgcaaccacggcggtaagggttagcctgacctctagcgttgcaatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35294279 |
gattttgtttgcaccatttaatcagagtgttctggcacaatgtgtgatggcagtgcaaccacggcggtaagggttagcctgacctctagcgttgcaatcg |
35294180 |
T |
 |
| Q |
118 |
tagtaagattgtcccttttgaccacatgggatattattagccttaagggcaccatagctaatgtatcttcttttcctgccggcc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35294179 |
tagtaagattgtcccttttgaccacatgggatattattagccttaagggcaccatagctaatgtatcttcttttcctgccggcc |
35294096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 20716804 - 20716975
Alignment:
| Q |
18 |
gattttgtttgcaccatttaatcagagtgttctggcacaatgtgtgatggcagtgcaaccacggcggtaagggttagcctgacctctagcgttgcaatca |
117 |
Q |
| |
|
||||||||||||| ||||| ||||||| || |||||||||||||||||||||||| |||||||| ||||||||| ||||| |||| ||||||||| |
|
|
| T |
20716804 |
gattttgtttgcatcatttcatcagagcactcgggcacaatgtgtgatggcagtgcatccacggcgataagggttaacctgatctctgtggttgcaatcg |
20716903 |
T |
 |
| Q |
118 |
tagtaagattgtcccttttgaccacatgggatattattagccttaagggcaccatagctaatgtatcttctt |
189 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||| |||| ||||||| |||||||||||||||||||| |
|
|
| T |
20716904 |
tagtatgattgtcccttaagaccacatgggatactatcagccagaagggcatcatagctaatgtatcttctt |
20716975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University