View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12810_high_6 (Length: 353)
Name: NF12810_high_6
Description: NF12810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12810_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 136 - 334
Target Start/End: Complemental strand, 46185190 - 46184984
Alignment:
| Q |
136 |
cccggttgaatataaatatatgatagtataagctagtgaaccaacc--------gaaccggtttggttcaatcaagcaccaggagctgcatccttaacct |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185190 |
cccggttgaatataaatatatgatagtataagctagtgaaccaaccaaccaaccgaaccggtttggttcaatcaagcaccaggagctgcatccttaacct |
46185091 |
T |
 |
| Q |
228 |
tactctgcaaataaccaccatattctcttgcataatctttaacatgagaagcagtatcataaaggcggttccttgcataatcaacccggtccgaaccggg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185090 |
tactctgcaaataaccaccatattctcttgcataatctttaacatgagaagcagtatcataaaggcggttccttgcataatcaacccggtccgaaccggg |
46184991 |
T |
 |
| Q |
328 |
aggatga |
334 |
Q |
| |
|
||||||| |
|
|
| T |
46184990 |
aggatga |
46184984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 6 - 114
Target Start/End: Complemental strand, 46185335 - 46185227
Alignment:
| Q |
6 |
agcagcacagaccaaaaaagtaacaaaagaatataaagatgacataacttaattccactaacaattatgattacgtacacacaccttaacttaattttga |
105 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46185335 |
agcatcacacaccaaaaaagtaacaaaagaatataaagatgacataacttaattccactaacaattatgattacgtacacacaccttaacttaatattga |
46185236 |
T |
 |
| Q |
106 |
accatacat |
114 |
Q |
| |
|
||||||||| |
|
|
| T |
46185235 |
accatacat |
46185227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University