View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12811_high_10 (Length: 212)

Name: NF12811_high_10
Description: NF12811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12811_high_10
NF12811_high_10
[»] chr6 (1 HSPs)
chr6 (32-103)||(10103198-10103267)


Alignment Details
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 32 - 103
Target Start/End: Complemental strand, 10103267 - 10103198
Alignment:
32 ggaaatccttcactaaataggctgatctttttagttcgagttcagttgaaagaagcttttagaattatatta 103  Q
    ||||||||||||||||||| |||||| ||||||||| ||||| |||||||||||||||||||||||||||||    
10103267 ggaaatccttcactaaataagctgat-tttttagtt-gagttaagttgaaagaagcttttagaattatatta 10103198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University