View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12811_low_13 (Length: 212)
Name: NF12811_low_13
Description: NF12811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12811_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 9 - 107
Target Start/End: Original strand, 50605963 - 50606061
Alignment:
| Q |
9 |
gcataggaggtggaggtggattaggccatggcataggtgttggtggtggaggtggactaggccatggtatcggtggcggcattggtggagggacgggag |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50605963 |
gcattggaggtggaggtggattaggccatggcataggtgttggtggtggaggtggactaggccatggtatcggtggtggcattggtggagggacgggag |
50606061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University