View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12811_low_8 (Length: 244)
Name: NF12811_low_8
Description: NF12811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12811_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 3414763 - 3414980
Alignment:
| Q |
17 |
ctttcaagtttttgagatcgaactaggtcaagaacgttggtggagcagcggtttaaccacaccaactgttaacccgaaacaacccacactaatcaatcca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
3414763 |
ctttcaagtttttgagatcgaactaggtcaagaacattggtggagcagcggtttaaccacaccaacggttaacccaaaacaacccacactaatcaatcca |
3414862 |
T |
|
| Q |
117 |
ctacatgaaaccccacccaaatagttgcaatgacaaacgatttaacggaaactagtagcaaatatcagtgaatcagaacaagatgtcatagatcatgagc |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3414863 |
ctacacgaaaccccacccaaatagttgcaatgacaaacgatttaacggaaactagtagcaaatatcagtgaatcagaacaagatgtcatagatcatgagc |
3414962 |
T |
|
| Q |
217 |
caacataaacgataacct |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3414963 |
caacataaacgataacct |
3414980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University