View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12812_high_15 (Length: 240)

Name: NF12812_high_15
Description: NF12812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12812_high_15
NF12812_high_15
[»] chr2 (1 HSPs)
chr2 (14-225)||(45380402-45380613)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 45380402 - 45380613
Alignment:
14 agactatgtcaaggaatggattgggagtcagatttgtccatcaaatgctgattgggatgatgatattggcagtgctaagatcaataacattcaggagaaa 113  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||     
45380402 agactatgtcaaggaatggattgggagtcaaatttgtccatcaaatgctgattgggatgatggtattggcagtgctaagatcaacaacattcaggagaag 45380501  T
114 tctgagttggaaaattcaagtccaactgataaagccagtgatgcaaatggaccacaattactacaagtatctgtgatggaaaatgcagataataaagttg 213  Q
    || |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
45380502 tcagagttggaaaattcaagtccaattgataaagccagtgatgcaaatggaacacaattactacaagtatctgtgatggaaaatgcagataataaagttg 45380601  T
214 ttgatatgaaag 225  Q
    ||||||||||||    
45380602 ttgatatgaaag 45380613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University