View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12812_low_14 (Length: 296)
Name: NF12812_low_14
Description: NF12812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12812_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 118 - 275
Target Start/End: Original strand, 32010642 - 32010799
Alignment:
| Q |
118 |
agtagaaagattggtgaaatggcggaactgaataaagaaactagggctgagagagtagataatttcaacattagtagtatgtgtatggtgtttgtgttag |
217 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32010642 |
agtagaaagatcggtgaaatggcgcaactgaataaagaaactagggctgagagagtagataatttcaacattagtagtatgtatatggtgtttgtgttag |
32010741 |
T |
 |
| Q |
218 |
gttgagtgggccaagtctgaaattattttggcctatgggtgttaaaccatgttggccc |
275 |
Q |
| |
|
||||||| ||| |||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32010742 |
gttgagttggcaaagtctaaaattattttggcctaagggtgttaaaccatgttggccc |
32010799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University