View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12812_low_18 (Length: 249)
Name: NF12812_low_18
Description: NF12812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12812_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 47711486 - 47711704
Alignment:
| Q |
18 |
aaccatttactagagacccgccacacttcttctcgcgcaatggtattatttttgacaataatgaaaattttgaccttgtaatgcagatatttgttgaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47711486 |
aaccatttactagagacccgccgcacttcttctcgcgcaatggtattatttttgacaataatgaaaattttgaccttgtaatgcagatatttgttgaaaa |
47711585 |
T |
 |
| Q |
118 |
ctgagtaaatatttttcctttttgcaatatatgaatgaaaaattcagtattgtatatagaaattagaaacaataaaaaagacaaactttagtactcatgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47711586 |
ctgagtaaatatttttcctttttgcaatttatgaatgaaaaattcagtattgtatatagaaattagaaacaataaaaaagacaaactttagtactcatgc |
47711685 |
T |
 |
| Q |
218 |
attgttttggagcacaggt |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47711686 |
attgttttggagcacaggt |
47711704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 45603623 - 45603672
Alignment:
| Q |
164 |
gtattgtatatagaaattagaaacaataaaaaagacaaactttagtactc |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
45603623 |
gtattgtatacagaaattagaaacaataaaaaagataaactttagcactc |
45603672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 43305530 - 43305474
Alignment:
| Q |
18 |
aaccatttactagagacccgccacacttcttctcgcgcaatggtattatttttgaca |
74 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
43305530 |
aaccatttgctagagcgccgccgcacttcttctcgtgcaatggtattatttttgaca |
43305474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University