View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12813_high_19 (Length: 215)
Name: NF12813_high_19
Description: NF12813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12813_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 198
Target Start/End: Complemental strand, 793430 - 793246
Alignment:
| Q |
14 |
atagggagggagctgatgaacggattctggcatgcaagcctcatctccaataccagatttctccaatactttgatatgaaagtctatgatttctttgtca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
793430 |
atagggagggagctgatgaacggattctggcatgcaagcctcatctccaataccagatttctccaatactttgatatgaaagtctatgatttctttgtca |
793331 |
T |
|
| Q |
114 |
aagttgtacaaatctaagtgttctatgaaatgggagtgagggagtctcaaattgtcaggaggtaaataacaaacatagtcaataa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
793330 |
aagttgtacaaatctaagtgttctatgaaatgggagtgagggagtctcaaattgtcaggaggtaaataacaaacatagtcaataa |
793246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 36 - 94
Target Start/End: Complemental strand, 994851 - 994793
Alignment:
| Q |
36 |
gattctggcatgcaagcctcatctccaataccagatttctccaatactttgatatgaaa |
94 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| | ||||||||||||| |||||| |
|
|
| T |
994851 |
gattctggcatgcaagcctcaactccaatattagatctttccaatactttgaaatgaaa |
994793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University