View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12813_low_11 (Length: 283)
Name: NF12813_low_11
Description: NF12813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12813_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 8 - 265
Target Start/End: Complemental strand, 47591296 - 47591039
Alignment:
| Q |
8 |
ttcaccttagaattgaactcaggtacaagccaaactattcaattcaactttagatgaagtgcagacaccacttgagttctattacttgattatcattgat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47591296 |
ttcaccttagaattgaactcaggtacaagccaaactattcaattcaactttagatgaagttcagacaccacttgagttctattacttgattatcattgat |
47591197 |
T |
 |
| Q |
108 |
tttttatatggcttgaagatattttggaagagagatagatgaattgagtcatgtaatattagttgaatgaaacttcacctttaattgttggaggagggct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47591196 |
tttttatatggcttgaagatattttggaagagagatagatgaattgagtcatgtaatattagttgaatgaaacttcacctttaattgttggaggagggct |
47591097 |
T |
 |
| Q |
208 |
aacttgcccaaacatctctggttcatcatcgttgttgtagaattgggacaatccaaac |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47591096 |
aacttgcccaaacatctctggttcatcatcgttgttgtagaattgggacaatccaaac |
47591039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University