View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12813_low_9 (Length: 342)
Name: NF12813_low_9
Description: NF12813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12813_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 125 - 325
Target Start/End: Original strand, 8255728 - 8255929
Alignment:
| Q |
125 |
tgccacctaagcaataaatcagcactacgtattcattgtataacaggaaaaatagataggcatatttttctctgtcaaaaatatattttgacatttctca |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
8255728 |
tgccacctaagcaataaatcagcactacgtattcattgtataacaggaaaaatagataggcttatttttctatgacaaaaatattttttgacatttctca |
8255827 |
T |
 |
| Q |
225 |
aagacgaaatttcatctgactttttagtttcgggacgaaaataattctttactctaattaatattcttaactctaattaatatag-aagacaaatgatta |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
8255828 |
aagacgaaatttcatctgactttttagtttcgggacgaaaattattctttactctaactaatattcttaactctaattaatattgaaagacaaatgatta |
8255927 |
T |
 |
| Q |
324 |
ct |
325 |
Q |
| |
|
|| |
|
|
| T |
8255928 |
ct |
8255929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University