View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12814_low_4 (Length: 224)
Name: NF12814_low_4
Description: NF12814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12814_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 19094774 - 19094587
Alignment:
| Q |
20 |
gctattgccatcatgtcaaggaattcaagcatgatgacagagatgccttcttcaattccattcaatacattatacttatgtaaatttggtacctttttta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19094774 |
gctattgccatcatgtcaaggaattcaagcatgatgacagagatgccttcttcaatttcattcaatacattatacttatgtaaatttggtacctttttta |
19094675 |
T |
 |
| Q |
120 |
tccgttaagaacgtcagtagtgaagctaggtcatcaaagagttatacagtagtctcattctgggttccaatgttccggtctacgacaca |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19094674 |
tccgttaagaacgt-agtagtgaagctaggtcatcaaagagttatacagtagtcccattctgggttccaatgttccggtctacgacaca |
19094587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University