View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12815_low_5 (Length: 206)
Name: NF12815_low_5
Description: NF12815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12815_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 30982560 - 30982751
Alignment:
| Q |
1 |
aaaattattgtgttttttcatgttattaattgtctnnnnnnnnc--ggtattgatcatatttctagtaaaaaagtattaattatgtttggaccacataaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
30982560 |
aaaattattgtgttttttcatgttattaattgtgttaaaaaaacacggtattgatcatatttctagtcaaaaagtattaattatatttggaccacataaa |
30982659 |
T |
 |
| Q |
99 |
aata--gtaaaaacaatattatttttaaccaataaatattatcaaaaggagaaaattctatttactgtttattttttgtattaaccatccaa |
188 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30982660 |
aatatagtaaaaacaatattatttttaaccaataaatattatcaaaaggagaaaattctatttactgttttttttttgtattaaccatccaa |
30982751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University