View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12816_high_13 (Length: 272)
Name: NF12816_high_13
Description: NF12816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12816_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 18 - 118
Target Start/End: Original strand, 31808961 - 31809061
Alignment:
| Q |
18 |
aaagggtctgtgaaatataacatggtgtgttactgaacttccgtgaataactgaaaatttatccaaacaaagaatggatataaaaaagggattatgatac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31808961 |
aaagggtctgtgaaatataacatggtgtgttactgaacttccgtgaataactgaaaatttatccaaacaaagaatggatataaaaaagggattatgatac |
31809060 |
T |
|
| Q |
118 |
c |
118 |
Q |
| |
|
| |
|
|
| T |
31809061 |
c |
31809061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 192 - 262
Target Start/End: Original strand, 31809134 - 31809204
Alignment:
| Q |
192 |
gtgtgtgacagaaaaagatgacctcattaaaaattaaaagcattgattttctttacactttctctcctatg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31809134 |
gtgtgtgacagaaaaagatgacctcattaaaaattaaaagcattgattttctttacactttctctcctatg |
31809204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University