View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12816_low_14 (Length: 271)
Name: NF12816_low_14
Description: NF12816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12816_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 17 - 256
Target Start/End: Original strand, 10973462 - 10973701
Alignment:
| Q |
17 |
aggttgaacaccccaataactggtaatccctttttcatctttgttatcaccagcaccaccctgagacgatggcggagttttgtcgacattcttgttgtca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10973462 |
aggttgaacaccccaataactggtaatccctttttcatctttgttatcaccagcaccaccctgagacgatggcggagttttgtcgacattcttgttgtct |
10973561 |
T |
 |
| Q |
117 |
ttctgatctgacagattagcagtaaaagtactagctttccttacaagaggggttgatctaaccaaataaccccatttgtttggaacaccaacttcaccac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10973562 |
ttctgatctgacagattagcagtaaaagtactagttttccttacaagaggggttgatctaaccaaataaccccatttgtttggaacaccaacttcaccac |
10973661 |
T |
 |
| Q |
217 |
ctaataaacccttctttgcaaacatcattgcagtgttcat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10973662 |
ctaataaacccttctttgcaaacatcattgcagtgttcat |
10973701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University