View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12818_high_3 (Length: 219)
Name: NF12818_high_3
Description: NF12818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12818_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 55173518 - 55173334
Alignment:
| Q |
17 |
agttccgtggaccatgtgcaagcagaaggatgctcccgatcccgtcgtaagtaattaattttaggcataaaacaaagtgaggacagtcatgatgtgatca |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55173518 |
agttccgtggatcatgtgcaagcagaaggatgctcccgatcccgtcgtaagtaattaattttaggcataaaacaaagtgaggacagtcatgatgtgatca |
55173419 |
T |
 |
| Q |
117 |
tgagtttaataattttatttggcagatcaatgcatgcaatggaagacattgtggtgataccttctcaggaccaaacaaaccatac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55173418 |
tgagtttaataattttatttggcagatcaatgcatgcaatggaagacattgtggtgataccttctcaggaccaaacaaaccatac |
55173334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 135 - 201
Target Start/End: Original strand, 27721586 - 27721652
Alignment:
| Q |
135 |
ttggcagatcaatgcatgcaatggaagacattgtggtgataccttctcaggaccaaacaaaccatac |
201 |
Q |
| |
|
||||||||| ||||||||||||||||| || |||||||||||||| |||| ||||||||||||||| |
|
|
| T |
27721586 |
ttggcagattaatgcatgcaatggaaggcactgtggtgatacctttacaggtccaaacaaaccatac |
27721652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University