View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12819_high_10 (Length: 249)
Name: NF12819_high_10
Description: NF12819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12819_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 233
Target Start/End: Original strand, 3266876 - 3267096
Alignment:
| Q |
13 |
gagagtcaaccttcagaatgagggttataaaatatgatggaaagctacaaggaagattaacgtgagaaaagaatttatcaaacatgacttttatattttc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
3266876 |
gagagtcaaccttcagaatgagggttataaaatatgatggaaagctacaaggaagattaacgtgagaaaagaattgatcaaacatgacttttatatcttc |
3266975 |
T |
 |
| Q |
113 |
cctcggaaggggccaaaaccttctgaagaaggaaaaattaaacacatccagaccctaactcttattgttgtgactgcttgccaccacatcatcaatctca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3266976 |
cctcggaaggggccaaaaccttctgaagaaggaaaaattaaacacgttcagaccctaactcttattgttgtgactgcttgccaccacatcatcaatctca |
3267075 |
T |
 |
| Q |
213 |
gtagcaagaaaagaaaccaac |
233 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
3267076 |
gtagcaagaaaagaaaacaac |
3267096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University