View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12819_high_8 (Length: 308)
Name: NF12819_high_8
Description: NF12819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12819_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 9 - 293
Target Start/End: Original strand, 15177303 - 15177587
Alignment:
| Q |
9 |
agcataggacttaacctgtgaagggtgaaggattcttgaagtgaggttgcgtcttaagaggcgccaaatgggaccgtagaagctaaagaggatgtcatgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15177303 |
agcataggacttaacctgtgaagggtgaaggattcttgaagtgaggttgcgtcttaagaggcgccaaatgggaccgtagaagctaaagaggatgtcatgt |
15177402 |
T |
|
| Q |
109 |
tgattgctgctaattatcttctttgtgggaatcgcctcagggcgatcagcgaatatggtgctattttggattaatgcttgatgtgcaagaaatctattgg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15177403 |
tgattgctgctaattatcttctttgtgggaaccgcctcagggcgatcagcgaatatggtgctattttggattaatgcttgatgtgcaagaaatctattgg |
15177502 |
T |
|
| Q |
209 |
caatgaaaatgtcggtgttagaacccatttgaagagtgaagattgaaccatatttggcatgaagatcttgaagaagggttttagg |
293 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15177503 |
caatgtaaatgtcggtgttagaacccatttgaagagtgaagattgaaccatatttggcatgaagatcttgaagaagggttttagg |
15177587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University