View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12819_low_17 (Length: 207)
Name: NF12819_low_17
Description: NF12819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12819_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 88 - 195
Target Start/End: Complemental strand, 11012890 - 11012786
Alignment:
| Q |
88 |
ccttctcatataatcaaacttatgtcttctgctataaggtcaatcaactatactacattcattgcttggaatttggatacggcttatatatctacgtgac |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11012890 |
ccttctcatataatcaaacttatgtcttct---ataaggtcaatcaactatactacattcattgcttggaatttggatacggcttatatatctacgtgac |
11012794 |
T |
|
| Q |
188 |
ctttgctt |
195 |
Q |
| |
|
|||||||| |
|
|
| T |
11012793 |
ctttgctt |
11012786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 11012968 - 11012909
Alignment:
| Q |
19 |
aagttgcagtttaaaattcgtatccaacctcnnnnnnnttgtaaagatcaaacttatgtc |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11012968 |
aagttgcagtttaaaattcgtatccaacctcaaaaaaattgtaaagatcaaacttatgtc |
11012909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University