View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12819_low_18 (Length: 202)
Name: NF12819_low_18
Description: NF12819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12819_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 72 - 183
Target Start/End: Complemental strand, 54229651 - 54229543
Alignment:
| Q |
72 |
ggaaaggaaagggg-tcatgttatacttctcctttacctttaccacacttccctcattttattagtaactctctctttcttttccttttgctttttagta |
170 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54229651 |
ggaaaggaaagggggtcatgttacacttctcctttacctttaccacacttccctcattttattagtaa----ctctttcttttccttttgctttttagta |
54229556 |
T |
 |
| Q |
171 |
ctctactctactc |
183 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
54229555 |
ctctactatactc |
54229543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University