View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12819_low_18 (Length: 202)

Name: NF12819_low_18
Description: NF12819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12819_low_18
NF12819_low_18
[»] chr4 (1 HSPs)
chr4 (72-183)||(54229543-54229651)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 72 - 183
Target Start/End: Complemental strand, 54229651 - 54229543
Alignment:
72 ggaaaggaaagggg-tcatgttatacttctcctttacctttaccacacttccctcattttattagtaactctctctttcttttccttttgctttttagta 170  Q
    |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||    
54229651 ggaaaggaaagggggtcatgttacacttctcctttacctttaccacacttccctcattttattagtaa----ctctttcttttccttttgctttttagta 54229556  T
171 ctctactctactc 183  Q
    ||||||| |||||    
54229555 ctctactatactc 54229543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University