View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1281_high_42 (Length: 276)

Name: NF1281_high_42
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1281_high_42
NF1281_high_42
[»] chr4 (2 HSPs)
chr4 (1-168)||(54252490-54252657)
chr4 (191-235)||(54252423-54252467)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 54252657 - 54252490
Alignment:
1 tgaagcttaagcacaagtacaagatggagatgtctttgcctgtggttgcagcagcttatgagatccaacaatgtttcatattttactgcagatttcttct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
54252657 tgaagcttaagcacaagtacaagatggagatgtctttgcctgtggttgcaacagcttatgagatccaacaatgtttcatattttactgcagatttcttct 54252558  T
101 atggcaaatgggtcttcttagattcttcttatgtcaaagatggggtactcaactaccgaatgtgtact 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54252557 atggcaaatgggtcttcttagattcttcttatgtcaaagatggggtactcaactaccgaatgtgtact 54252490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 191 - 235
Target Start/End: Complemental strand, 54252467 - 54252423
Alignment:
191 atgttgttgttttgctttttgattatcattatcatgttgttcttg 235  Q
    |||||||||||||||||||||||||||||||| ||||| ||||||    
54252467 atgttgttgttttgctttttgattatcattatgatgttattcttg 54252423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University