View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_high_51 (Length: 212)
Name: NF1281_high_51
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_high_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 36 - 161
Target Start/End: Original strand, 27687365 - 27687490
Alignment:
| Q |
36 |
atgaacaaacctagatctaaaaggacagaactgatatcattaatcaagtgaaacagagaggagtaaacgaaaacacgttttgaattaggtgcagtgcaca |
135 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27687365 |
atgaacaaacctacatctgaaaggacagaattgatatcgttaatcaagtgaaacagagaggagcaaacgaaaacacgttttgaattaggtgcagtgcacg |
27687464 |
T |
 |
| Q |
136 |
acgtacttgccgggagcaatcaaacc |
161 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
27687465 |
acgtagttgccgggagcaatcaaacc |
27687490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 37 - 155
Target Start/End: Original strand, 27687248 - 27687366
Alignment:
| Q |
37 |
tgaacaaacctagatctaaaaggacagaactgatatcattaatcaagtgaaacagagaggagtaaacgaaaacacgttttgaattaggtgcagtgcacaa |
136 |
Q |
| |
|
||||||||||||| | | |||||||||||| |||||| | ||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||| | |
|
|
| T |
27687248 |
tgaacaaacctagttttgaaaggacagaaccgatatcgtcaatcaagagaaacagagaggagcaaacaaaaacacgttttgaattaggtgcagtgcacga |
27687347 |
T |
 |
| Q |
137 |
cgtacttgccgggagcaat |
155 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
27687348 |
tgtagttgccgggagcaat |
27687366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University