View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1281_low_12 (Length: 610)

Name: NF1281_low_12
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1281_low_12
NF1281_low_12
[»] chr6 (2 HSPs)
chr6 (103-270)||(31055546-31055710)
chr6 (268-345)||(31056501-31056576)
[»] chr3 (3 HSPs)
chr3 (487-610)||(27687365-27687488)
chr3 (488-606)||(27687248-27687366)
chr3 (57-102)||(53451477-53451522)
[»] scaffold0202 (2 HSPs)
scaffold0202 (268-320)||(6267-6319)
scaffold0202 (268-360)||(19558-19649)


Alignment Details
Target: chr6 (Bit Score: 134; Significance: 2e-69; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 103 - 270
Target Start/End: Original strand, 31055546 - 31055710
Alignment:
103 ttaagaaaattgagcctaatgcagataattgaaaccaagaaaaacggtctaacacgtctttttcattataaacttgcagaatacaaaatatgactacctt 202  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
31055546 ttaagaaaattgagcttaatgcagataattgaaaccaagaaaaacggtctaacacgtctttttcattataaacttgcagaatacaaaatatggctacctt 31055645  T
203 ttaaaatattatagtgccatttgatctatgaccgacgaccacctttagtgggataaggtttggttgtt 270  Q
    |||||| ||||| ||| |||||||||||||||   |||||||||||||||||||||||||||||||||    
31055646 ttaaaacattatggtgtcatttgatctatgac---cgaccacctttagtgggataaggtttggttgtt 31055710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 268 - 345
Target Start/End: Original strand, 31056501 - 31056576
Alignment:
268 gttgtagatcttacatgatttggattatccggaggaagagtagatgttgaaccccatatacatgttatataaccttat 345  Q
    ||||||||||||||||||||||||||||  |||||||||||||||||||||  || ||||||||||||||||||||||    
31056501 gttgtagatcttacatgatttggattatatggaggaagagtagatgttgaa--ccgtatacatgttatataaccttat 31056576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 100; Significance: 4e-49; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 100; E-Value: 4e-49
Query Start/End: Original strand, 487 - 610
Target Start/End: Original strand, 27687365 - 27687488
Alignment:
487 atgaacaaacctagatctaaaaggacagaactgatatcattaatcaagtgaaacagagaggagtaaacgaaaacacgttttgaattaggtgcagtgcaca 586  Q
    ||||||||||||| |||| ||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||     
27687365 atgaacaaacctacatctgaaaggacagaattgatatcgttaatcaagtgaaacagagaggagcaaacgaaaacacgttttgaattaggtgcagtgcacg 27687464  T
587 acgtagttgccgggagcaatcaaa 610  Q
    ||||||||||||||||||||||||    
27687465 acgtagttgccgggagcaatcaaa 27687488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 488 - 606
Target Start/End: Original strand, 27687248 - 27687366
Alignment:
488 tgaacaaacctagatctaaaaggacagaactgatatcattaatcaagtgaaacagagaggagtaaacgaaaacacgttttgaattaggtgcagtgcacaa 587  Q
    ||||||||||||| | | |||||||||||| |||||| | ||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||| |    
27687248 tgaacaaacctagttttgaaaggacagaaccgatatcgtcaatcaagagaaacagagaggagcaaacaaaaacacgttttgaattaggtgcagtgcacga 27687347  T
588 cgtagttgccgggagcaat 606  Q
     ||||||||||||||||||    
27687348 tgtagttgccgggagcaat 27687366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 57 - 102
Target Start/End: Complemental strand, 53451522 - 53451477
Alignment:
57 tatgtgtctgtgtatttgtttgcttcacccacttctcttctttctc 102  Q
    ||||||||| |||||||||||||||| |||||| ||||||||||||    
53451522 tatgtgtctatgtatttgtttgcttctcccactgctcttctttctc 53451477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0202 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0202
Description:

Target: scaffold0202; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 6319 - 6267
Alignment:
268 gttgtagatcttacatgatttggattatccggaggaagagtagatgttgaacc 320  Q
    ||||||||||||||||||||||||| ||| |||||||| | ||||||||||||    
6319 gttgtagatcttacatgatttggatcatctggaggaagggcagatgttgaacc 6267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0202; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 268 - 360
Target Start/End: Original strand, 19558 - 19649
Alignment:
268 gttgtagatcttacatgatttggattatccggaggaagagtagatgttgaaccccatatacatgttatataaccttattgagtcgtatgatat 360  Q
    ||||||||||||||||||||||||| ||| |||||||| | | ||||||||  ||  ||||||| ||||| ||||| |||| |||||| ||||    
19558 gttgtagatcttacatgatttggatcatctggaggaagggcatatgttgaa-acctcatacatgatatatcacctttttgaatcgtatcatat 19649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University