View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_low_27 (Length: 415)
Name: NF1281_low_27
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_low_27 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 5e-69; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 248 - 415
Target Start/End: Original strand, 40270902 - 40271074
Alignment:
| Q |
248 |
taccttgggaaatgcaagat-----gggggtcacagtaggagcattttagtttccataaaccctatggtatactaccacccccctcattttggttaccct |
342 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40270902 |
taccttgggaaatgcaagatctgaagggggtcacagtaggagcattttagtttccatagagcctatggtatactaccacccccctcattttggttaccct |
40271001 |
T |
 |
| Q |
343 |
cttcttcattttcttcaacacactcactcaatctcactcaccatgagttctatacccaacctacgtcactcca |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
40271002 |
cttcttcattttcttcaacacactcactcaatctcactcaccatgaattccatacccaacctccgtcactcca |
40271074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 146 - 186
Target Start/End: Original strand, 40270801 - 40270841
Alignment:
| Q |
146 |
ctattcaaaagcgctgaaatgagatgacacaagatttgaaa |
186 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40270801 |
ctattcaagagcgctgaaatgagatgacacaagatttgaaa |
40270841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University