View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_low_45 (Length: 306)
Name: NF1281_low_45
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 90 - 210
Target Start/End: Original strand, 3598359 - 3598479
Alignment:
| Q |
90 |
ctgtaaatgttgcaaaagaccaagcagttggtgcagaaaaccccgtaaatgacactttaggtggttcggatgttttagtgagtgataaagcacatgctgc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3598359 |
ctgtaaatgttgcaaaagaccaagcagttggtgcagaaaaccccgtaaatgacactttaggtggttcggatgttttagtgaatgataaagcacatgctgc |
3598458 |
T |
 |
| Q |
190 |
cgaaaattctataaatgatac |
210 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3598459 |
cgaaaattctataaatgatac |
3598479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University