View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_low_47 (Length: 302)
Name: NF1281_low_47
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 47198087 - 47197791
Alignment:
| Q |
1 |
gacctgcatacagatggcaatgatcaatggaggacgattgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47198087 |
gacctgcatacagatggcaatgatcaatggaggacgattgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctg |
47197988 |
T |
|
| Q |
101 |
agtatgtcttcaaactcgggctcaatattttcaacaccacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47197987 |
agtatgtcttcaaactcgggctcaatattttcaacaccacgaatctttgtaagaacggctttccctttctcctcgaaacccctttcaatgagactgttgg |
47197888 |
T |
|
| Q |
201 |
gagtatcatccactatgagagaccccattgtaagcataactgctggaatgattgctccagccaatgataatctccacccatatccacctttgcttct |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
47197887 |
gagtatcatccactatgagagaccccattgtaagcataactgctggaatgattgctccagccaatgatactctccacccatatccacctttgattct |
47197791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 2 - 290
Target Start/End: Complemental strand, 47185204 - 47184916
Alignment:
| Q |
2 |
acctgcatacagatggcaatgatcaatggaggacgattgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctga |
101 |
Q |
| |
|
||||||||||| |||||||| ||||| ||||| |||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
47185204 |
acctgcatacatatggcaattatcaaaggagggagattgtgggacttaacaagatccttgaaggggctcttgacctcattagccactttactagctctga |
47185105 |
T |
|
| Q |
102 |
gtatgtcttcaaactcgggctcaatattttcaacaccacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttggg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47185104 |
gtatgtcttcaaactcgggctcaatattttcaacaccacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttggg |
47185005 |
T |
|
| Q |
202 |
agtatcatccactatgagagaccccattgtaagcataactgctggaatgattgctccagccaatgataatctccacccatatccacctt |
290 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
47185004 |
agtatcatccactatgagagaccccactgtaagcataactgctggaatgattgctccggccaatgatattctccacccatatccacctt |
47184916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7060 times since January 2019
Visitors: 1273