View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1281_low_54 (Length: 287)

Name: NF1281_low_54
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1281_low_54
NF1281_low_54
[»] chr2 (1 HSPs)
chr2 (49-174)||(9093680-9093806)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 49 - 174
Target Start/End: Complemental strand, 9093806 - 9093680
Alignment:
49 atgaatcgttcttcttctcttcgattgaaaggcgaattcgatttgggttcagttaccagtctaccaccacttacaaattatattatttgc-nnnnnnnnc 147  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||         |    
9093806 atgaatcgttcttcttctcttcgattgaaaggggaattcgatttgggttcagctaccagtctaccaccacttacaaattatattatttgctttttttttc 9093707  T
148 cctaaaaaatattatttgttttcgtaa 174  Q
    | |||||||||||||||||||||||||    
9093706 cgtaaaaaatattatttgttttcgtaa 9093680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University