View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_low_54 (Length: 287)
Name: NF1281_low_54
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 49 - 174
Target Start/End: Complemental strand, 9093806 - 9093680
Alignment:
| Q |
49 |
atgaatcgttcttcttctcttcgattgaaaggcgaattcgatttgggttcagttaccagtctaccaccacttacaaattatattatttgc-nnnnnnnnc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9093806 |
atgaatcgttcttcttctcttcgattgaaaggggaattcgatttgggttcagctaccagtctaccaccacttacaaattatattatttgctttttttttc |
9093707 |
T |
|
| Q |
148 |
cctaaaaaatattatttgttttcgtaa |
174 |
Q |
| |
|
| ||||||||||||||||||||||||| |
|
|
| T |
9093706 |
cgtaaaaaatattatttgttttcgtaa |
9093680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University