View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_low_57 (Length: 284)
Name: NF1281_low_57
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 33 - 273
Target Start/End: Original strand, 27465626 - 27465863
Alignment:
| Q |
33 |
tcaggtctaatgtcccccagtttttgtactcctcttttttatttatgtgattttctattttgcctnnnnnnnnntatatgtagatgtctagagttgattt |
132 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
27465626 |
tcaggtctaatgtcccccagtttttatactcctcttttttatttatgtgattttctattttgcctcaaaaaa---atatatagatgtctagagttgattt |
27465722 |
T |
 |
| Q |
133 |
ctcataggaaattaaatgttcggatggttcaaagtggagacggttcctacaagatggggaagtatgctgatggagaattcaacatttgggaaaggcacgt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27465723 |
ctcataggaaattaaatgttcggatggttcaaagtggagacggttcctacaagatggggcagtatgctgatggagaattcaacatttggggaaggcacgt |
27465822 |
T |
 |
| Q |
233 |
gcaaattaagcaaataaagtacaacacatgctacctttcat |
273 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
27465823 |
gcaaattaatctaataaagtacaacacatgctacctttcat |
27465863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 95
Target Start/End: Original strand, 7763503 - 7763537
Alignment:
| Q |
61 |
ctcctcttttttatttatgtgattttctattttgc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7763503 |
ctcctcttttttatttatgtgattttctattttgc |
7763537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University