View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_low_71 (Length: 251)
Name: NF1281_low_71
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_low_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 38571366 - 38571286
Alignment:
| Q |
137 |
gtcacttaaagataccctaatatttcatattaagatactatactaacctcttcagcagtgattatagcttttatgtgctgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38571366 |
gtcacttaaagataccctaatatttcatattaagatactatactaacctcttcagcagtgattatagcttttatgtgctgc |
38571286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 54
Target Start/End: Complemental strand, 38571472 - 38571435
Alignment:
| Q |
17 |
acatcatcatccattgggtctctaaccaatacctataa |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38571472 |
acatcatcatccattgggtctctaaccaatacctataa |
38571435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University