View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1281_low_71 (Length: 251)

Name: NF1281_low_71
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1281_low_71
NF1281_low_71
[»] chr7 (2 HSPs)
chr7 (137-217)||(38571286-38571366)
chr7 (17-54)||(38571435-38571472)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 137 - 217
Target Start/End: Complemental strand, 38571366 - 38571286
Alignment:
137 gtcacttaaagataccctaatatttcatattaagatactatactaacctcttcagcagtgattatagcttttatgtgctgc 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38571366 gtcacttaaagataccctaatatttcatattaagatactatactaacctcttcagcagtgattatagcttttatgtgctgc 38571286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 54
Target Start/End: Complemental strand, 38571472 - 38571435
Alignment:
17 acatcatcatccattgggtctctaaccaatacctataa 54  Q
    ||||||||||||||||||||||||||||||||||||||    
38571472 acatcatcatccattgggtctctaaccaatacctataa 38571435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University