View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_low_73 (Length: 230)
Name: NF1281_low_73
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_low_73 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 117 - 230
Target Start/End: Original strand, 39793431 - 39793544
Alignment:
| Q |
117 |
ctctccctgcaacaggtttgtttctacttcccacaaaaatgggacggagcacaactaaagatcccatcatacgaagtggtaggttgccaagaaaacccta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39793431 |
ctctccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgccaagaaaaaccta |
39793530 |
T |
|
| Q |
217 |
cgtttaccgccgct |
230 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
39793531 |
caattaccgccgct |
39793544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University