View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_low_79 (Length: 211)
Name: NF1281_low_79
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_low_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 22363001 - 22362796
Alignment:
| Q |
1 |
tttatttagtgaatataggtgaaggtcagagacttcatgtcatatgcagttttgacccctctacaagtttaggtgatacttttcaggtacatatatgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22363001 |
tttatttagtgaatataggtgaaggtcagagacttcatgtcatatgcagttttgacccctctacaagtttaggtgatacttttcaggtacatatatgctt |
22362902 |
T |
 |
| Q |
101 |
ctataatttcacatgtttcacttacatattatccactttatgttaacttgttaccatgtttttctaacattcttcaattttatgtagcctttctatattg |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362901 |
ctataatttcacatgtttcactcacatattatccactttatgttatcttgttaccatgtttttctaacattcttcaattttatgtagcctttctatattg |
22362802 |
T |
 |
| Q |
201 |
ttggag |
206 |
Q |
| |
|
||||| |
|
|
| T |
22362801 |
gtggag |
22362796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University