View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_low_80 (Length: 211)
Name: NF1281_low_80
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_low_80 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 22362977 - 22363158
Alignment:
| Q |
1 |
ccttcacctatattcactaaataaaatacagtacctgctggaattacatacaaatcccccgtctttattctcctttcctctagttcatctccatatatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362977 |
ccttcacctatattcactaaataaaatacagtacctgctggaattacatacaaatcccctgtctttattctcctttcctctagttcatctccatatatga |
22363076 |
T |
|
| Q |
101 |
atcccaactttgctacccctgcatccaagttgaaaatttcactctaaatttctctaatgacttgatgttcacttgttgcttc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22363077 |
atcccaactttgctacccctgcatccaagttgaaaatttcactctaaatttctctaatgacttgatgttcacttgttgcttc |
22363158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2102 times since January 2019
Visitors: 5791