View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1281_low_81 (Length: 211)
Name: NF1281_low_81
Description: NF1281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1281_low_81 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 22363001 - 22362803
Alignment:
| Q |
1 |
tttatttagtgaatataggtgaaggtcagagacttcatgtcatatgcagttttgacccctctacaagtttaggtgatacttttcaggtacatatatgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22363001 |
tttatttagtgaatataggtgaaggtcagagacttcatgtcatatgcagttttgacccctctacaagtttaggtgatacttttcaggtacatatatgctt |
22362902 |
T |
 |
| Q |
101 |
ctataatttcacatgtttcacttacatattatccactttatgttaacttgttaccatgtttttctaacattcttcaattttatgtagcctttctatatt |
199 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362901 |
ctataatttcacatgtttcactcacatattatccactttatgttatcttgttaccatgtttttctaacattcttcaattttatgtagcctttctatatt |
22362803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University