View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_high_52 (Length: 240)
Name: NF12820_high_52
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 26 - 222
Target Start/End: Original strand, 17768435 - 17768631
Alignment:
| Q |
26 |
cttcaaggtacatgcaatgcgaacaaaaagcttgacttatgcaaagaaagtacgtataggagtcaaaactcaataatcatcccagttaaaccattgtcct |
125 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17768435 |
cttcaaggtacatgcaatgcgaataaaaagcttgacttatgcaaagaaagtacgtataggagtcaaaactcaataatcatcccagttaaaccattgtcct |
17768534 |
T |
 |
| Q |
126 |
taataacacattttgcacatcaaaattacttccacgaaacttatatatgcaggtaagtgcccacttaagatcatgattattcccttcatgcagttct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17768535 |
taataacacattttgcacatcaaaattacttccacgaaacttatatatgcaggtaagtgccctcttaagatcatgattattcccttcatgcagttct |
17768631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University