View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_low_27 (Length: 384)
Name: NF12820_low_27
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 230 - 367
Target Start/End: Complemental strand, 25933607 - 25933470
Alignment:
| Q |
230 |
tacttagcttgaagaagcagactctatgagtaataaaaagttgagaattttgaatatgattttgagggtgcatagaagcgtttcctttacgttttctttg |
329 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933607 |
tacttagcttgaagaagcagattctatgagtaataaaaagttgagaattttgaatatgattttgagggtgcatagaagcgtttcctttacgttttctttg |
25933508 |
T |
|
| Q |
330 |
cagaaaaaacaaagagtgatagagaaaaagatatgtgc |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933507 |
cagaaaaaacaaagagtgatagagaaaaagatatgtgc |
25933470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 44 - 162
Target Start/End: Complemental strand, 25933785 - 25933667
Alignment:
| Q |
44 |
gatgcttcttacatggaagaaaatcagaagtagaatagtagcaatccatgtcattgctataagcttcaacacctttgtttctatccttcattgctttact |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25933785 |
gatgcttcttacatggaagaaaatcagaagtagaatagtagcaatccatgtcattgctataagcttcaacacctttgtttctctccttcattgctttact |
25933686 |
T |
|
| Q |
144 |
ctaaactagatttagtttc |
162 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25933685 |
ctaaactagatttagtttc |
25933667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University