View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_low_29 (Length: 368)
Name: NF12820_low_29
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_low_29 |
 |  |
|
| [»] scaffold0110 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0110 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 16 - 358
Target Start/End: Original strand, 3228 - 3570
Alignment:
| Q |
16 |
ccttttcctctacattctcttcttcccttcctacatgagtctcactcatcctaactcaacatcatcaacccttaatcccattttcccaacaacattaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3228 |
ccttttcctctacattctcttcttcccttcctacatgagtctcactcatcctaactcaacatcatcaacccttaatcccattttcccaacaacattaaca |
3327 |
T |
 |
| Q |
116 |
atcccttcattccaagaacagtcatatgttaaaggctgtcctttatctctctcaaatgaactcttcaatggcatagaaagtgcatgtagttcatcaaaac |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3328 |
atcccttcattccaagaacagtcttatgttaaaggctgtcctttatctctctcaaatgaactcttcaatggcatagaaagtgcatgtagttcatcaaaac |
3427 |
T |
 |
| Q |
216 |
atggttctaatactaaactcgaccgtagccgatgttgtccagttcttgcagcatggttatactcttcatactcctccactgcccttggaaaccattcatc |
315 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3428 |
atggttctaatagtaaactcgaccgtagccgatgttgtccgattcttgcagcatggttatactcttcatactcctccactgcccttggaaaccattcatc |
3527 |
T |
 |
| Q |
316 |
ttcgtcgtcgtcgtcatcaagatcatcatttgacatgcctttg |
358 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3528 |
atcatcgtcgtcgtcatcaagatcatcatttgacatgcctttg |
3570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University