View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_low_36 (Length: 303)
Name: NF12820_low_36
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 50 - 295
Target Start/End: Original strand, 42227192 - 42227437
Alignment:
| Q |
50 |
gtcaccacactttaagtaaccgatcccgtgccaagcatcaaatttaattgtaaggcttaaactcacagttctttagtgtctagatacctcgtgaattggt |
149 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227192 |
gtcaccacactttaagtaaccgatctcgtgccaagcatcaaatttaattgtaaggcttaaactcacagttctttagtgtctagatacctcgtgaattggt |
42227291 |
T |
 |
| Q |
150 |
agtactgatgtagttctgctgtgtagtgaaacacaagtaactccaaaatgataaaatcagtgttttcaaaactgaatgaacggaccaaccagttgaacct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227292 |
agtactgatgtagttctgctgtgtagtgaaacacaagtaactccaaaatgataaaatcagtgttttcaaaactgaatgaacggaccaaccagttgaacct |
42227391 |
T |
 |
| Q |
250 |
tgaattgacttttattataggtcggttattttcacggtttcatctc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227392 |
tgaattgacttttattataggtcggttattttcacggtttcatctc |
42227437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University